OralDosed ingredientTherapeutic flag
Disulfiram
CAS 97-77-8
Disulfiram (CAS 97-77-8) is a Phase 4 pharmaceutical compound with 42 bioactivity targets and 248 adverse event associations.
SOURCE
NLM DailyMed
Label records
0
SOURCE
EMBL-EBI ChEMBL
Bioactivity
52
SOURCE
DrugCentral
Adverse signals
248
SOURCE
IUPHAR/BPS
PubMed IDs
6
SOURCE
EMBL-EBI ChEMBL
B25820EEF0F0
Compound Identity
Matched identifiers and naming fields for the pharmaceutical compound record.
Primary Name
Disulfiram
CAS Number
97-77-8
UNII
TR3MLJ1UAI
InChIKey
AUZONCFQVSMFAP-UHFFFAOYSA-N
ChEMBL ID
CHEMBL964
Molecule Type
Small molecule
Source Match
EMBL-EBI ChEMBL (INCHIKEY)
Synonyms and normalized names
Antabuse
black box warningdosed ingredientnatural productoraltherapeutic flag
SOURCE
EMBL-EBI ChEMBL
B25820EEF0F0
Clinical Development Phase
Highest clinical development phase rendered from the matched compound identifier rows.
Phase 4 (Approved)
Approved or marketed human pharmaceutical use is represented in the source phase field.
ChEMBL CHEMBL964 | Small molecule
SOURCE
EMBL-EBI ChEMBL
52 bioactivity rows
Bioactivity & Target Interactions
Target-level activity records with assay counts, activity type, and measured value where present.
| Target | Activity | Value | Assays | Organism |
|---|---|---|---|---|
| - | Potency | 12251.835546875 nM | 146 | - |
| - | IC50 | 12802.424220183486 nM | 108 | - |
| - | AC50 | 19907.85230769231 nM | 45 | - |
| - | MIC | 22914.634146341465 nM | 41 | - |
| - | Ki | 10017.619047619048 nM | 21 | - |
| - | MIC | 4.416666666666667 ug.mL-1 | 12 | - |
| - | EC50 | 9680.857142857143 nM | 7 | - |
| - | IC50 | 3.2 | 1 | - |
| Fructose-1,6-bisphosphatase 1 Enzyme |
IC50 | 6.22 | - | Homo sapiens |
| Sodium/nucleoside cotransporter 1 Transporter |
Ki | 5.237 | - | Homo sapiens |
| Mu-type opioid receptor GPCR |
Ki | 5.846 | - | Homo sapiens |
| Translocator protein Transporter |
- | - | - | Homo sapiens |
| D(1A) dopamine receptor GPCR |
Ki | 5.967 | - | Homo sapiens |
| D(2) dopamine receptor GPCR |
Ki | 5.115 | - | Homo sapiens |
| Alpha-2A adrenergic receptor GPCR |
Ki | 5.735 | - | Homo sapiens |
| Sodium-dependent noradrenaline transporter Transporter |
Ki | 4.156 | - | Homo sapiens |
| 5-hydroxytryptamine receptor 2B GPCR |
Ki | 4.658 | - | Homo sapiens |
| 5-hydroxytryptamine receptor 6 GPCR |
Ki | 5.129 | - | Homo sapiens |
| Alpha-2B adrenergic receptor GPCR |
Ki | 5.833 | - | Homo sapiens |
| D(3) dopamine receptor GPCR |
Ki | 6.434 | - | Homo sapiens |
| Sodium-dependent dopamine transporter Transporter |
Ki | 5.434 | - | Homo sapiens |
| Adenosine receptor A3 GPCR |
Ki | 6.697 | - | Homo sapiens |
| D(4) dopamine receptor GPCR |
Ki | 5.957 | - | Homo sapiens |
| Kappa-type opioid receptor GPCR |
Ki | 5.612 | - | Homo sapiens |
| Cytochrome P450 1A2 Enzyme |
IC50 | 5.398 | - | Homo sapiens |
| Amine oxidase [flavin-containing] A Enzyme |
IC50 | 4.862 | - | Homo sapiens |
| Aldehyde dehydrogenase, mitochondrial Enzyme |
INHIBITOR | - | - | Homo sapiens |
| Retinal dehydrogenase 1 Enzyme |
IC50 | 6.89 | - | Homo sapiens |
| cAMP-specific 3',5'-cyclic phosphodiesterase 4A Enzyme |
IC50 | 5.319 | - | Homo sapiens |
| C-C chemokine receptor type 5 GPCR |
Ki | 4.738 | - | Homo sapiens |
| C-X-C chemokine receptor type 2 GPCR |
Ki | 5.376 | - | Homo sapiens |
| C-C chemokine receptor type 2 GPCR |
Ki | 6.02 | - | Homo sapiens |
| Mitogen-activated protein kinase 3 Kinase |
IC50 | 5.821 | - | Homo sapiens |
| Arachidonate 15-lipoxygenase Enzyme |
IC50 | 4.794 | - | Oryctolagus cuniculus |
| 5-hydroxytryptamine receptor 1B GPCR |
Ki | 5.669 | - | Rattus norvegicus |
| C-C chemokine receptor type 4 GPCR |
Ki | 5.357 | - | Homo sapiens |
| Membrane-associated progesterone receptor component 1 Membrane receptor |
Ki | 4.333 | - | Rattus norvegicus |
| Aldehyde dehydrogenase, mitochondrial Enzyme |
IC50 | 4.4 | - | Rattus norvegicus |
| Monoglyceride lipase Enzyme |
IC50 | 5.9 | - | Homo sapiens |
| Bifunctional protein GlmU Enzyme |
IC50 | 4.07 | - | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
| Replicase polyprotein 1ab Enzyme |
IC50 | 5.98 | - | Severe acute respiratory syndrome coronavirus 2 (2019-nCoV) (SARS-CoV-2) |
| Protein-lysine 6-oxidase Enzyme |
IC50 | 6.5 | - | Homo sapiens |
| Lysine-specific demethylase 5A Enzyme |
IC50 | 5 | - | Homo sapiens |
| Lysyl oxidase homolog 3 Enzyme |
IC50 | 7.03 | - | Homo sapiens |
| Lysyl oxidase homolog 4 Enzyme |
IC50 | 7.23 | - | Homo sapiens |
| Histone-lysine N-methyltransferase EHMT2 Enzyme |
IC50 | 6.22 | - | Homo sapiens |
| Histone-lysine N-methyltransferase EHMT1 Enzyme |
IC50 | 5.8 | - | Homo sapiens |
| Lysyl oxidase homolog 2 Enzyme |
IC50 | 6.82 | - | Homo sapiens |
| Gasdermin-D Unclassified |
IC50 | 6.4 | - | Homo sapiens |
| NACHT, LRR and PYD domains-containing protein 3 Unclassified |
IC50 | 5.52 | - | Mus musculus |
SOURCE
DrugCentral
28 associations
Adverse Event Associations
DrugCentral / FAERS disproportionality signal rows matched to this compound.
| Reaction PT | Drug AE | LLR | MedDRA |
|---|---|---|---|
| Psychiatric symptom | 43 | 168.568 | 10061472 |
| Drug abuse | 79 | 132.454 | 10013654 |
| Milk-alkali syndrome | 25 | 128.412 | 10027635 |
| Intentional self-injury | 48 | 124.311 | 10022524 |
| Alcohol intolerance | 21 | 124.279 | 10001598 |
| Drug interaction | 100 | 98.835 | 10013710 |
| Intentional overdose | 48 | 72.835 | 10022523 |
| Sopor | 30 | 68.249 | 10058709 |
| Toxicity to various agents | 75 | 56.133 | 10070863 |
| Alcohol interaction | 16 | 55.261 | 10001597 |
| Metabolic alkalosis | 15 | 52.444 | 10027423 |
| Overdose | 46 | 43.549 | 10033295 |
| Psychotic disorder | 25 | 43.08 | 10061920 |
| Hypertonia neonatal | 9 | 42.492 | 10048615 |
| Suicide attempt | 32 | 42.201 | 10042464 |
| Generalised tonic-clonic seizure | 24 | 40.724 | 10018100 |
| Jarisch-Herxheimer reaction | 9 | 40.408 | 10023125 |
| Hypercalcaemia | 23 | 40.238 | 10020583 |
| Bradyphrenia | 15 | 39.287 | 10050012 |
| Dysarthria | 26 | 35.785 | 10013887 |
| Off label use | 109 | 35.624 | 10053762 |
| Agitation neonatal | 9 | 35.45 | 10001500 |
| Dissociation | 11 | 35.131 | 10013457 |
| Depressed level of consciousness | 29 | 34.745 | 10012373 |
| Antipsychotic drug level increased | 12 | 34.416 | 10063686 |
| Hepatitis acute | 14 | 31.013 | 10019727 |
| Reduced facial expression | 9 | 31.004 | 10078576 |
| Dissociative disorder | 7 | 30.679 | 10013462 |
Association rows are source-linked signal records, not incidence rates or clinical causality claims.
SOURCE
IUPHAR/BPS
2 interactions
IUPHAR Ligand-Target Data
Curated ligand-target interaction rows with action, affinity, and literature identifiers.
| Target | Action | Affinity | PubMed |
|---|---|---|---|
| aldehyde dehydrogenase 2 family member Aldh2 |
Inhibition | 4.440000057220459 pIC50 | 10974203 |
| gasdermin D Gsdmd |
Inhibition | 6.400000095367432 pIC50 | 31191857 |
SOURCE
PharmGKB
9 phenotype rows
Pharmacogenomics
Drug-gene phenotype annotations and evidence levels from PharmGKB-mapped rows.
MTHFR (PA245) rs1801133
Genotypes AA + AG are associated with increased response to disulfiram in people with Cocaine-Related Disorders as compared to genotype GG.
Evidence: -; PMID 23335901
ANKK1 (PA134872551) rs1800497
Genotypes AA + AG are associated with increased likelihood of response when treated with disulfiram in people with Cocaine-Related Disorders as compared to genotype GG.
Evidence: -; PMID 23635803
DRD2 (PA27478) rs2283265
Genotypes AA + AC are associated with increased likelihood of response when treated with disulfiram in people with Cocaine-Related Disorders.
Evidence: -; PMID 23635803
SLC6A3 (PA311) rs28363170
Genotype GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT is associated with increased response to disulfiram in people with Cocaine-Related Disorders as compared to genotypes GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/del + del/del.
Evidence: -; PMID 31087723
DRD2 rs2283265
Cocaine dependence
Evidence: 3; PMID 1
ANKK1 rs1800497
Cocaine dependence
Evidence: 3; PMID 1
MTHFR rs1801133
Cocaine dependence
Evidence: 3; PMID 1
OPRD1 rs678849
Cocaine dependence
Evidence: 3; PMID 1
SLC6A3 rs28363170
Cocaine dependence
Evidence: 3; PMID 1
SOURCE
NLM RxNorm
3 name rows
Drug Names / RxNorm
Normalized drug-name vocabulary rows, RxCUIs, and source abbreviations.
| Name | RxCUI | Type | Source |
|---|---|---|---|
| DISULFIRAM | 3554 | SU | MTHSPL |
| disulfiram | 3554 | IN | RXNORM |
| Antabuse | 151358 | BN | RXNORM |
SOURCE
SIDER
65 side-effect rows
Side Effects
SIDER side-effect terms mapped to the drug or same-CAS compound identity.
| Side Effect | Drug Name | MedDRA Type | Concept ID |
|---|---|---|---|
| Abdominal discomfort | disulfiram | PT | C0232487 |
| Acneiform eruption | disulfiram | LLT | C0175167 |
| Asthenia | disulfiram | LLT | C0004093 |
| Asthenia | disulfiram | PT | C0004093 |
| Asthenia | disulfiram | PT | C0004093 |
| Breath odour | disulfiram | LLT | C0018520 |
| Breath odour | disulfiram | PT | C0018520 |
| Dermatitis acneiform | disulfiram | PT | C0234894 |
| Dermatitis atopic | disulfiram | LLT | C0011615 |
| Dermatitis atopic | disulfiram | PT | C0011615 |
| Dizziness | disulfiram | LLT | C0012833 |
| Dizziness | disulfiram | PT | C0012833 |
| Drowsiness | disulfiram | LLT | C0013144 |
| Erectile dysfunction | disulfiram | LLT | C0242350 |
| Erectile dysfunction | disulfiram | PT | C0242350 |
| Eruption | disulfiram | LLT | C0302295 |
| Eye pain | disulfiram | LLT | C0151827 |
| Eye pain | disulfiram | PT | C0151827 |
| Fatigability | disulfiram | LLT | C0231230 |
| Fatigue | disulfiram | LLT | C0015672 |
| Fatigue | disulfiram | PT | C0015672 |
| Fatigue | disulfiram | PT | C0015672 |
| Fatigue | disulfiram | PT | C0015672 |
| Headache | disulfiram | LLT | C0018681 |
| Headache | disulfiram | PT | C0018681 |
| Hepatic failure | disulfiram | LLT | C0085605 |
| Hepatic failure | disulfiram | PT | C0085605 |
| Hepatic necrosis | disulfiram | LLT | C0151798 |
| Hepatic necrosis | disulfiram | PT | C0151798 |
| Hepatitis | disulfiram | LLT | C0019158 |
| Hepatitis | disulfiram | PT | C0019158 |
| Hepatitis fulminant | disulfiram | LLT | C0302809 |
| Hepatitis fulminant | disulfiram | PT | C0302809 |
| Hypoaesthesia | disulfiram | PT | C0020580 |
| Jaundice | disulfiram | LLT | C0022346 |
| Jaundice | disulfiram | PT | C0022346 |
| Lassitude | disulfiram | LLT | C0086525 |
| Neuritis | disulfiram | LLT | C0027813 |
| Neuritis | disulfiram | PT | C0027813 |
| Neuropathy | disulfiram | LLT | C0442874 |
| Neuropathy peripheral | disulfiram | PT | C0031117 |
| Neuropathy peripheral | disulfiram | LLT | C0031117 |
| Neuropathy peripheral | disulfiram | PT | C0031117 |
| Neuropathy peripheral | disulfiram | PT | C0031117 |
| Numbness | disulfiram | LLT | C0028643 |
| Optic neuritis | disulfiram | LLT | C0029134 |
| Optic neuritis | disulfiram | PT | C0029134 |
| Pain | disulfiram | LLT | C0030193 |
| Pain | disulfiram | PT | C0030193 |
| Paraesthesia | disulfiram | PT | C0030554 |
| Peripheral sensorimotor neuropathy | disulfiram | LLT | C1112256 |
| Peripheral sensorimotor neuropathy | disulfiram | PT | C1112256 |
| Polyneuritis | disulfiram | LLT | C0032541 |
| Polyneuropathy | disulfiram | PT | C0152025 |
| Psychotic disorder | disulfiram | LLT | C0033975 |
| Psychotic disorder | disulfiram | PT | C0033975 |
| Rash | disulfiram | PT | C0015230 |
| Sensory loss | disulfiram | PT | C0278134 |
| Somnolence | disulfiram | PT | C2830004 |
| Stress | disulfiram | LLT | C0038435 |
| Stress | disulfiram | PT | C0038435 |
| Tenderness | disulfiram | LLT | C0234233 |
| Tenderness | disulfiram | PT | C0234233 |
| Tingling sensation | disulfiram | LLT | C2242996 |
| Upset stomach | disulfiram | LLT | C0235309 |
SOURCE
Rendered pharma page rows
FAQPage JSON-LD
Frequently Asked Questions
Short answers generated only from the same visible source-linked rows on this page.
What is Disulfiram used for in pharmaceutical contexts?
Disulfiram (CAS 97-77-8) is rendered as a pharmaceutical compound from the matched source rows; no DailyMed product-name rows are present in this page query.
What are the known adverse events for Disulfiram?
Disulfiram has 248 DrugCentral/FAERS adverse event associations. Rendered reaction terms include Psychiatric symptom, Drug abuse, Milk-alkali syndrome, Intentional self-injury, Alcohol intolerance. Signal rows are source-linked records and should not be read as incidence rates or causality conclusions.
Is Disulfiram also used in cosmetics?
No same-CAS cosmetics profile is rendered from the ingredients-table cross-reference for Disulfiram.
What clinical phase is Disulfiram in?
Disulfiram is rendered with ChEMBL max phase 4 (approved).
What bioactivity targets are documented for Disulfiram?
Disulfiram has 52 bioactivity rows in this page query. Rendered target entries include Fructose-1,6-bisphosphatase 1, Sodium/nucleoside cotransporter 1, Mu-type opioid receptor, Translocator protein, D(1A) dopamine receptor.