OralParenteralDosed ingredient
Cosmetic cross-reference
Folic Acid
CAS 59-30-3
Folic Acid (CAS 59-30-3) is a Phase 4 pharmaceutical compound with 3 bioactivity targets and 10,140 adverse event associations.
SOURCE
NLM DailyMed
Label records
0
SOURCE
EMBL-EBI ChEMBL
Bioactivity
9
SOURCE
DrugCentral
Adverse signals
10,140
SOURCE
IUPHAR/BPS
PubMed IDs
9
SOURCE
EMBL-EBI ChEMBL
B25820EEF0F0
Compound Identity
Matched identifiers and naming fields for the pharmaceutical compound record.
Primary Name
Folic Acid
CAS Number
59-30-3
UNII
935E97BOY8
InChIKey
OVBPIULPVIDEAO-LBPRGKRZSA-N
ChEMBL ID
CHEMBL1622
Molecule Type
Small molecule
Source Match
EMBL-EBI ChEMBL (INCHIKEY)
Synonyms and normalized names
Folacin
dosed ingredientnatural productoralparenteral
SOURCE
EMBL-EBI ChEMBL
B25820EEF0F0
Clinical Development Phase
Highest clinical development phase rendered from the matched compound identifier rows.
Phase 4 (Approved)
Approved or marketed human pharmaceutical use is represented in the source phase field.
ChEMBL CHEMBL1622 | Small molecule
SOURCE
Ingredients table / CosIng profile
same-CAS cross-reference
Cross-Reference to Cosmetics
Same-CAS ingredient record found in the cosmetics vertical.
SOURCE
EMBL-EBI ChEMBL
9 bioactivity rows
Bioactivity & Target Interactions
Target-level activity records with assay counts, activity type, and measured value where present.
| Target | Activity | Value | Assays | Organism |
|---|---|---|---|---|
| - | AC50 | 29378.93134328358 nM | 67 | - |
| - | Potency | 26471.013636363637 nM | 20 | - |
| - | IC50 | 38590.524 nM | 4 | - |
| - | Kd | 2502.75 nM | 4 | - |
| - | Ki | 21016.666666666668 nM | 3 | - |
| Thymidylate synthase Enzyme |
Ki | 4.4 | - | Homo sapiens |
| Aldose reductase Enzyme |
IC50 | 4.28 | - | Homo sapiens |
| Dihydrofolate reductase Enzyme |
Kd | 6.09 | - | Escherichia coli (strain K12) |
| Dihydrofolate reductase Enzyme |
Kd | 6.09 | - | Escherichia coli |
SOURCE
DrugCentral
80 associations
Adverse Event Associations
DrugCentral / FAERS disproportionality signal rows matched to this compound.
| Reaction PT | Drug AE | LLR | MedDRA |
|---|---|---|---|
| Pemphigus | 5400 | 2448.911 | 10034280 |
| Systemic lupus erythematosus | 5737 | 2361.926 | 10042945 |
| Glossodynia | 4958 | 2053.427 | 10018388 |
| Hand deformity | 4335 | 1732.159 | 10061194 |
| Rheumatoid arthritis | 6031 | 1628.826 | 10039073 |
| Arthropathy | 5592 | 1592.039 | 10003285 |
| Maternal exposure during pregnancy | 4974 | 1537.993 | 10071408 |
| Alopecia | 6818 | 1505.326 | 10001760 |
| Completed suicide | 172 | 1429.093 | 10010144 |
| Abdominal discomfort | 6909 | 1425.914 | 10000059 |
| Wound | 4204 | 1409.889 | 10052428 |
| Toxicity to various agents | 1108 | 1407.697 | 10070863 |
| Synovitis | 4261 | 1186.972 | 10042868 |
| Joint swelling | 6460 | 1078.389 | 10023232 |
| Anti-cyclic citrullinated peptide antibody positive | 2940 | 1067.825 | 10068798 |
| Swelling | 5552 | 1047.454 | 10042674 |
| Contraindicated product administered | 4742 | 1043.237 | 10078504 |
| Discomfort | 3841 | 1017.175 | 10013082 |
| Pericarditis | 3255 | 1006.931 | 10034484 |
| Pain | 12345 | 959.928 | 10033371 |
| Death | 3527 | 946.062 | 10011906 |
| Infusion related reaction | 5395 | 934.237 | 10051792 |
| Drug abuse | 151 | 926.614 | 10013654 |
| Foetal exposure during pregnancy | 2523 | 850.639 | 10071404 |
| Arthralgia | 9830 | 756.738 | 10003239 |
| Exposure during pregnancy | 3259 | 755.336 | 10073513 |
| Duodenal ulcer perforation | 2096 | 673.189 | 10013849 |
| Drug interaction | 1865 | 657.658 | 10013710 |
| Helicobacter infection | 2162 | 646.053 | 10054263 |
| Rheumatoid factor positive | 1968 | 639.097 | 10039080 |
| Psoriatic arthropathy | 2254 | 612.222 | 10037162 |
| Hepatic enzyme increased | 3917 | 584.895 | 10060795 |
| Intentional overdose | 148 | 584.869 | 10022523 |
| Musculoskeletal stiffness | 3744 | 582.214 | 10052904 |
| Product use issue | 4487 | 543.069 | 10076309 |
| Febrile neutropenia | 910 | 513.583 | 10016288 |
| Drug intolerance | 5274 | 496.897 | 10061822 |
| Therapeutic product effect decreased | 3570 | 466.611 | 10082201 |
| Disease progression | 917 | 416.193 | 10061818 |
| Overdose | 784 | 405.138 | 10033295 |
| Suicide attempt | 185 | 378.437 | 10042464 |
| Nasopharyngitis | 4416 | 375.625 | 10028810 |
| Knee arthroplasty | 1277 | 361.525 | 10023469 |
| Acute kidney injury | 3126 | 355.941 | 10069339 |
| Hip arthroplasty | 1132 | 336.662 | 10020096 |
| Sickle cell anaemia with crisis | 399 | 318.283 | 10040642 |
| Cardiac arrest | 688 | 314.938 | 10007515 |
| Impaired healing | 1952 | 310.085 | 10021519 |
| Hypersensitivity | 4612 | 303.941 | 10020751 |
| Small for dates baby | 410 | 302.327 | 10041092 |
Association rows are source-linked signal records, not incidence rates or clinical causality claims.
SOURCE
PharmGKB
29 phenotype rows
Pharmacogenomics
Drug-gene phenotype annotations and evidence levels from PharmGKB-mapped rows.
C18orf56 (PA134956204),"TYMS (PA359)" rs45445694
Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with increased response to folic acid, hydroxychloroquine, methotrexate and sulfasalazine in people with Arthritis, Rheumatoid as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.
Evidence: -; PMID 18322994
MTHFR (PA245) rs1801131
Allele G is not associated with decreased risk of Abortion, Spontaneous when treated with folic acid or levomefolic acid in women with Abortion, Spontaneous as compared to allele T.
Evidence: -; PMID 26630680
AMPD1 (PA24776) rs17602729
Allele A is associated with increased response to folic acid and methotrexate in people with Arthritis, Rheumatoid as compared to allele G.
Evidence: -; PMID 16947783
ATIC (PA25094) rs2372536
Allele C is not associated with response to folic acid, hydroxychloroquine, methotrexate and sulfasalazine in people with Arthritis, Rheumatoid as compared to allele G.
Evidence: -; PMID 18322994
ITPA (PA29973) rs1127354
Genotype CC is associated with increased response to folic acid and methotrexate in people with Arthritis, Rheumatoid as compared to genotypes AA + AC.
Evidence: -; PMID 16947783
MTHFR (PA245) rs1801131
Allele G is not associated with response to folic acid, hydroxychloroquine, methotrexate and sulfasalazine in people with Arthritis, Rheumatoid.
Evidence: -; PMID 18322994
SLC19A1 (PA327) rs1051266
Allele T is associated with increased response to folic acid, hydroxychloroquine, methotrexate and sulfasalazine in people with Arthritis, Rheumatoid as compared to allele C.
Evidence: -; PMID 18322994
MTHFR (PA245) rs1801133
Allele A is not associated with response to folic acid, hydroxychloroquine, methotrexate and sulfasalazine in people with Arthritis, Rheumatoid.
Evidence: -; PMID 18322994
DHFR (PA143) rs70991108
Allele del is not associated with response to folic acid, hydroxychloroquine, methotrexate and sulfasalazine in people with Arthritis, Rheumatoid.
Evidence: -; PMID 18322994
MTR (PA31272) rs1805087
Allele A is associated with increased response to folic acid, hydroxychloroquine, methotrexate and sulfasalazine in people with Arthritis, Rheumatoid as compared to allele G.
Evidence: -; PMID 18322994
TLR4 (PA36552) rs4986790
Allele G is associated with increased risk of adverse drug events when treated with folic acid and methotrexate in people with Arthritis, Rheumatoid as compared to allele A.
Evidence: -; PMID 20136356
ATIC (PA25094) rs2372536
Allele G is associated with increased likelihood of any adverse drug event when treated with folic acid and methotrexate in people with Arthritis, Rheumatoid as compared to allele C.
Evidence: -; PMID 16947783
MTHFR (PA245) rs1801131
Genotypes GG + GT are associated with increased overall survival when treated with bevacizumab, cyanocobalamin, folic acid and pemetrexed in people with Head and Neck Neoplasms as compared to genotype TT.
Evidence: -; PMID 21343546
MTHFR (PA245) rs1801133
Genotypes AG + GG are associated with greater reduction in homocysteine when treated with folic acid and vitamin b-complex, plain in women with Migraine with Aura as compared to genotype AA.
Evidence: -; PMID 22926161
MTRR (PA31277) rs1801394
Genotypes AA + AG are associated with decreased severity of Pain when treated with folic acid and vitamin b-complex, plain in women with Migraine with Aura as compared to genotype GG.
Evidence: -; PMID 22926161
ABCB1 (PA267) rs1045642
Allele A is associated with increased risk of adverse drug event when treated with folic acid and methotrexate in people with Arthritis, Rheumatoid as compared to allele G.
Evidence: -; PMID 20136356
MTHFR (PA245) rs1801133
Allele A is not associated with decreased risk of Abortion, Spontaneous when treated with folic acid or levomefolic acid in women with Abortion, Spontaneous as compared to allele G.
Evidence: -; PMID 26630680
MTHFR (PA245) rs1801131
Allele G is associated with decreased metabolism of folic acid.
Evidence: -; PMID 29317847
MTHFR (PA245) rs1801133
Allele A is associated with decreased metabolism of folic acid.
Evidence: -; PMID 29317847
SHMT1 (PA35753) rs1979277
Allele A is not associated with response to folic acid, hydroxychloroquine, methotrexate and sulfasalazine in people with Arthritis, Rheumatoid.
Evidence: -; PMID 18322994
TYMS (PA359) rs11280056
Allele del is associated with increased response to folic acid, hydroxychloroquine, methotrexate and sulfasalazine in people with Arthritis, Rheumatoid as compared to allele TTAAAGTTA.
Evidence: -; PMID 18322994
MTHFR (PA245) rs1801133
Genotypes AG + GG are associated with decreased severity of Pain when treated with folic acid and vitamin b-complex, plain in women with Migraine with Aura as compared to genotype AA.
Evidence: -; PMID 22926161
ATIC (PA25094) rs2372536
Genotype CC is associated with increased response to folic acid and methotrexate in people with Arthritis, Rheumatoid as compared to genotypes CG + GG.
Evidence: -; PMID 16947783
MTRR rs1801394
Migraine with Aura
Evidence: 3; PMID 1
MTHFR rs1801131
Neoplasms
Evidence: 3; PMID 4
TLR4 rs4986790
Rheumatoid arthritis
Evidence: 3; PMID 1
MTHFR rs1801133
-
Evidence: 3; PMID 1
MTR rs1805087
Rheumatoid arthritis
Evidence: 3; PMID 1
MTHFR rs1801133
-
Evidence: 3; PMID 1
SOURCE
NLM RxNorm
5 name rows
Drug Names / RxNorm
Normalized drug-name vocabulary rows, RxCUIs, and source abbreviations.
| Name | RxCUI | Type | Source |
|---|---|---|---|
| Folic Acid | 4511 | SU | MTHSPL |
| folic acid | 4511 | SU | MTHSPL |
| FOLIC ACID | 4511 | SU | MTHSPL |
| folic acid | 4511 | IN | RXNORM |
| Folacin | 202634 | BN | RXNORM |
SOURCE
SIDER
50 side-effect rows
Side Effects
SIDER side-effect terms mapped to the drug or same-CAS compound identity.
| Side Effect | Drug Name | MedDRA Type | Concept ID |
|---|---|---|---|
| Abdominal distension | folate | LLT | C0000731 |
| Abdominal distension | folate | PT | C0000731 |
| Agitation | folate | PT | C0085631 |
| Agitation | folate | PT | C0085631 |
| Anaphylactic shock | folate | LLT | C0002792 |
| Anaphylactic shock | folate | PT | C0002792 |
| Anorexia | folate | LLT | C0003123 |
| Bad taste | folate | LLT | C0541799 |
| Bronchospasm | folate | LLT | C0006266 |
| Bronchospasm | folate | PT | C0006266 |
| Confusional state | folate | LLT | C0009676 |
| Confusional state | folate | PT | C0009676 |
| Convulsion | folate | LLT | C0036572 |
| Convulsion | folate | PT | C0036572 |
| Decreased appetite | folate | PT | C0232462 |
| Depression | folate | LLT | C0011570 |
| Depression | folate | PT | C0011570 |
| Dermatitis | folate | PT | C0011603 |
| Digestion impaired | folate | LLT | C0232459 |
| Discomfort | folate | PT | C0234215 |
| Dysgeusia | folate | PT | C0013378 |
| Dyspepsia | folate | PT | C0013395 |
| Dyspnoea | folate | LLT | C0013404 |
| Dyspnoea | folate | PT | C0013404 |
| Erythema | folate | LLT | C0041834 |
| Erythema | folate | PT | C0041834 |
| Excitement | folate | LLT | C0233571 |
| Feeling abnormal | folate | PT | C1443060 |
| Feeling abnormal | folate | PT | C1443060 |
| Flatulence | folate | LLT | C0016204 |
| Flatulence | folate | PT | C0016204 |
| Gastrointestinal disorder | folate | PT | C0017178 |
| Ill-defined disorder | folate | PT | C2047937 |
| Irritability | folate | LLT | C0022107 |
| Irritability | folate | PT | C0022107 |
| Judgement impaired | folate | LLT | C0233818 |
| Judgement impaired | folate | PT | C0233818 |
| Malaise | folate | LLT | C0231218 |
| Malaise | folate | PT | C0231218 |
| Nausea | folate | LLT | C0027497 |
| Nausea | folate | PT | C0027497 |
| Overactivity | folate | LLT | C1536696 |
| Pruritus | folate | LLT | C0033774 |
| Pruritus | folate | PT | C0033774 |
| Rash | folate | LLT | C0015230 |
| Rash | folate | PT | C0015230 |
| Sensitisation | folate | LLT | C1325847 |
| Sensitisation | folate | PT | C1325847 |
| Vitamin B12 deficiency | folate | LLT | C0042847 |
| Vitamin B12 deficiency | folate | PT | C0042847 |
SOURCE
Rendered pharma page rows
FAQPage JSON-LD
Frequently Asked Questions
Short answers generated only from the same visible source-linked rows on this page.
What is Folic Acid used for in pharmaceutical contexts?
Folic Acid (CAS 59-30-3) is rendered as a pharmaceutical compound from the matched source rows; no DailyMed product-name rows are present in this page query.
What are the known adverse events for Folic Acid?
Folic Acid has 10,140 DrugCentral/FAERS adverse event associations. Rendered reaction terms include Pemphigus, Systemic lupus erythematosus, Glossodynia, Hand deformity, Rheumatoid arthritis. Signal rows are source-linked records and should not be read as incidence rates or causality conclusions.
Is Folic Acid also used in cosmetics?
Yes. The ingredients table has a same-CAS cosmetic profile for Folic Acid with EU status "permitted".
What clinical phase is Folic Acid in?
Folic Acid is rendered with ChEMBL max phase 4 (approved).
What bioactivity targets are documented for Folic Acid?
Folic Acid has 9 bioactivity rows in this page query. Rendered target entries include Thymidylate synthase, Aldose reductase, Dihydrofolate reductase.