OralParenteralDosed ingredientTherapeutic flag
Cosmetic cross-reference
Methotrexate
CAS 59-05-2
Methotrexate (CAS 59-05-2) is a Phase 4 pharmaceutical compound with 18 bioactivity targets and 2,431 adverse event associations.
SOURCE
NLM DailyMed
Label records
0
SOURCE
EMBL-EBI ChEMBL
Bioactivity
49
SOURCE
DrugCentral
Adverse signals
2,431
SOURCE
IUPHAR/BPS
PubMed IDs
46
SOURCE
EMBL-EBI ChEMBL
B25820EEF0F0
Compound Identity
Matched identifiers and naming fields for the pharmaceutical compound record.
Primary Name
Methotrexate
CAS Number
59-05-2
UNII
YL5FZ2Y5U1
InChIKey
FBOZXECLQNJBKD-ZDUSSCGKSA-N
ChEMBL ID
CHEMBL34259
Molecule Type
Small molecule
Source Match
EMBL-EBI ChEMBL (INCHIKEY)
Synonyms and normalized names
methotrexate sodiumTrexall
black box warningdosed ingredientnatural productoralparenteraltherapeutic flag
SOURCE
EMBL-EBI ChEMBL
B25820EEF0F0
Clinical Development Phase
Highest clinical development phase rendered from the matched compound identifier rows.
Phase 4 (Approved)
Approved or marketed human pharmaceutical use is represented in the source phase field.
ChEMBL CHEMBL34259 | Small molecule
SOURCE
Ingredients table / CosIng profile
same-CAS cross-reference
Cross-Reference to Cosmetics
Same-CAS ingredient record found in the cosmetics vertical.
SOURCE
EMBL-EBI ChEMBL
49 bioactivity rows
Bioactivity & Target Interactions
Target-level activity records with assay counts, activity type, and measured value where present.
| Target | Activity | Value | Assays | Organism |
|---|---|---|---|---|
| - | IC50 | 4976.344322850318 nM | 1236 | - |
| - | GI50 | 11926.832469387755 nM | 98 | - |
| - | AC50 | 21482.823711340207 nM | 97 | - |
| - | EC50 | 1583.967415730337 nM | 89 | - |
| - | Potency | 17886.8064516129 nM | 87 | - |
| - | IC50 | 12.308452742424242 ug.mL-1 | 66 | - |
| - | Ki | 9085.242024242425 nM | 33 | - |
| - | Kd | 298.8015833333333 nM | 12 | - |
| - | Ki | 1.1933428571428573 | 7 | - |
| - | MIC | 472249.71428571426 nM | 7 | - |
| - | MIC | 129.14285714285714 ug.mL-1 | 7 | - |
| - | Kd | 48.08956 | 5 | - |
| - | GI50 | 5.55 | 1 | - |
| Multidrug resistance protein 1 Transporter |
- | - | - | Homo sapiens |
| Canalicular multispecific organic anion transporter 1 Transporter |
- | - | - | Homo sapiens |
| Multidrug resistance-associated protein 1 Transporter |
- | - | - | Homo sapiens |
| ATP-binding cassette sub-family G member 2 Transporter |
- | - | - | Homo sapiens |
| Thymidylate synthase Enzyme |
Ki | 6.22 | - | Homo sapiens |
| Multidrug resistance-associated protein 5 Transporter |
- | - | - | Homo sapiens |
| Folylpolyglutamate synthase, mitochondrial Enzyme |
IC50 | 5.49 | - | Homo sapiens |
| Multidrug resistance-associated protein 4 Transporter |
- | - | - | Homo sapiens |
| Bifunctional dihydrofolate reductase-thymidylate synthase Enzyme |
IC50 | 8.85 | - | Toxoplasma gondii |
| Dihydrofolate reductase Enzyme |
IC50 | 9 | - | Pneumocystis carinii |
| Folate receptor beta Membrane receptor |
IC50 | 6.97 | - | Homo sapiens |
| Bifunctional dihydrofolate reductase-thymidylate synthase Enzyme |
IC50 | 7.08 | - | Plasmodium falciparum |
| Proton-coupled folate transporter Transporter |
IC50 | 6.92 | - | Homo sapiens |
| Dihydrofolate reductase Enzyme |
Ki | 5.41 | - | Mus musculus |
| Dihydrofolate reductase Enzyme |
Ki | 10.14 | - | Rattus norvegicus |
| Dihydrofolate reductase Enzyme |
Ki | 10.68 | - | Escherichia coli (strain K12) |
| Dihydrofolate reductase Enzyme |
IC50 | 8.89 | - | Lactobacillus casei |
| Thymidylate synthase Enzyme |
Ki | 4.35 | - | Mus musculus |
| Bifunctional dihydrofolate reductase-thymidylate synthase Enzyme |
Ki | 9.89 | - | Leishmania major |
| Dihydrofolate reductase Enzyme |
IC50 | 7.72 | - | Gallus gallus |
| Thymidylate synthase Enzyme |
IC50 | 4.4 | - | Lactobacillus casei |
| Dihydrofolate reductase Enzyme |
Ki | 10.68 | - | Escherichia coli |
| Thymidylate synthase Enzyme |
IC50 | 5.74 | - | Escherichia coli |
| Pteridine reductase 1 Enzyme |
Ki | 7.41 | - | Leishmania major |
| Bifunctional dihydrofolate reductase-thymidylate synthase Enzyme |
IC50 | 6.96 | - | Trypanosoma cruzi |
| Dihydrofolate reductase Enzyme |
Ki | 9 | - | Staphylococcus aureus |
| Dihydrofolate reductase Enzyme |
IC50 | 8.08 | - | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
| Toll-like receptor 4 Membrane receptor |
IC50 | 5.98 | - | Homo sapiens |
| Dihydrofolate reductase Enzyme |
IC50 | 7.91 | - | Bacillus anthracis |
| Dihydrofolate reductase Enzyme |
IC50 | 8.77 | - | Bos taurus |
| Dihydrofolate reductase Enzyme |
IC50 | 8.85 | - | Enterococcus faecium |
| Folate transporter 1 Transporter |
Ki | 5.46 | - | Homo sapiens |
| Folate receptor alpha Membrane receptor |
IC50 | 6.94 | - | Homo sapiens |
| High mobility group protein B1 Nuclear other |
Kd | 7.62 | - | Homo sapiens |
| Bifunctional purine biosynthesis protein PURH Enzyme |
Ki | 6.06 | - | Homo sapiens |
| Dihydrofolate reductase Enzyme |
Ki | 8.92 | - | Homo sapiens |
SOURCE
DrugCentral
80 associations
Adverse Event Associations
DrugCentral / FAERS disproportionality signal rows matched to this compound.
| Reaction PT | Drug AE | LLR | MedDRA |
|---|---|---|---|
| Drug ineffective | 59729 | 20687.912 | 10013709 |
| Drug intolerance | 17099 | 7205.96 | 10061822 |
| Treatment failure | 12026 | 5270.38 | 10066901 |
| Joint swelling | 15253 | 5003.251 | 10023232 |
| Arthralgia | 22408 | 4198.672 | 10003239 |
| Death | 3450 | 4193.036 | 10011906 |
| Contraindicated product administered | 10173 | 3397.113 | 10078504 |
| Rheumatoid arthritis | 11146 | 3334.638 | 10039073 |
| Drug hypersensitivity | 13205 | 3204.107 | 10013700 |
| Therapeutic product effect incomplete | 7813 | 3153.024 | 10082200 |
| Therapeutic product effect decreased | 9293 | 3143.835 | 10082201 |
| Synovitis | 8627 | 3139.96 | 10042868 |
| Completed suicide | 97 | 3113.436 | 10010144 |
| Musculoskeletal stiffness | 8590 | 2541.445 | 10052904 |
| Arthropathy | 8870 | 2017.987 | 10003285 |
| Drug abuse | 138 | 1951.051 | 10013654 |
| Constipation | 1578 | 1881.496 | 10010774 |
| Lymphoproliferative disorder | 1148 | 1844.934 | 10061232 |
| Hypotension | 2828 | 1815.902 | 10021097 |
| Acute kidney injury | 3664 | 1783.662 | 10069339 |
| Pain | 21818 | 1738.407 | 10033371 |
| Psoriasis | 4832 | 1714.21 | 10037153 |
| Alopecia | 10460 | 1606.467 | 10001760 |
| Psoriatic arthropathy | 4503 | 1566.532 | 10037162 |
| Liver function test increased | 2664 | 1545.914 | 10077692 |
| Dyspnoea | 9125 | 1480.946 | 10013968 |
| Arthritis | 5124 | 1378.58 | 10003246 |
| Dehydration | 1405 | 1365.747 | 10012174 |
| Infection | 9206 | 1290.326 | 10021789 |
| Intentional overdose | 156 | 1253.259 | 10022523 |
| Hyponatraemia | 672 | 1239.913 | 10021036 |
| Somnolence | 1573 | 1208.938 | 10041349 |
| Hyperkalaemia | 208 | 1160.901 | 10020646 |
| Swelling | 8617 | 1128.247 | 10042674 |
| Bradycardia | 403 | 1120.02 | 10006093 |
| Cardiac arrest | 707 | 1091.401 | 10007515 |
| Rhabdomyolysis | 170 | 1086.191 | 10039020 |
| Dizziness | 5468 | 1075.967 | 10013573 |
| Acute graft versus host disease | 1181 | 1070.927 | 10066260 |
| Anaemia | 4159 | 1067.025 | 10002034 |
| Red blood cell sedimentation rate increased | 2508 | 1059.105 | 10049187 |
| Abdominal discomfort | 9798 | 1058.769 | 10000059 |
| Hepatic enzyme increased | 6922 | 1050.587 | 10060795 |
| C-reactive protein increased | 4789 | 1037.616 | 10006825 |
| Drug interaction | 3453 | 1031.373 | 10013710 |
| Electrocardiogram QT prolonged | 151 | 1019.107 | 10014387 |
| C-reactive protein abnormal | 2463 | 1005.494 | 10068559 |
| Systemic lupus erythematosus | 6345 | 954.285 | 10042945 |
| Overdose | 1135 | 946.459 | 10033295 |
| Condition aggravated | 13662 | 931.595 | 10010264 |
Association rows are source-linked signal records, not incidence rates or clinical causality claims.
SOURCE
IUPHAR/BPS
3 interactions
IUPHAR Ligand-Target Data
Curated ligand-target interaction rows with action, affinity, and literature identifiers.
| Target | Action | Affinity | PubMed |
|---|---|---|---|
| dihydrofolate reductase DHFR |
Inhibition | 8.920000076293945 pKi | 7877140 |
| Reduced folate transporter 1 SLC19A1 |
Inhibition | 5.329999923706055 pKi | 15615544 |
| high mobility group box 1 HMGB1 |
Inhibition | 7.619999885559082 pKd | 29268019 |
SOURCE
PharmGKB
60 phenotype rows
Pharmacogenomics
Drug-gene phenotype annotations and evidence levels from PharmGKB-mapped rows.
HLA-G (PA35083) rs371194629
Genotype del/del is not associated with increased response to methotrexate in people with Arthritis, Rheumatoid.
Evidence: -; PMID 19088262
MTHFR (PA245) rs1801133
Genotypes AA + AG are associated with increased likelihood of treatment interruptions when treated with methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotype GG.
Evidence: -; PMID 18458567
MTHFR (PA245) rs1801133
Allele A is not associated with risk of Drug Toxicity when treated with methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to allele G.
Evidence: -; PMID 12915598
MTHFR (PA245) rs1801133
Genotype AA is associated with increased risk of gastrointestinal toxicity, Leukopenia and Toxic liver disease when treated with methotrexate in people with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotype GG.
Evidence: -; PMID 19648163
MTHFR (PA245) rs1801133
Genotype AG is not associated with increased likelihood of Myelosuppression when treated with mercaptopurine and methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotype GG.
Evidence: -; PMID 17323057
MTHFR (PA245) rs1801133
Genotypes AA + AG are associated with increased risk of discontinuation when treated with methotrexate in people with Arthritis, Rheumatoid as compared to genotype GG.
Evidence: -; PMID 11710708
TPMT (PA356) TPMT*1, TPMT*12
TPMT *12 is associated with increased severity of Drug Toxicity when treated with mercaptopurine and methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to TPMT *1.
Evidence: -; PMID 22838948
TYMS (PA359) rs45445694
Allele (CCGCGCCACTTCGCCTGCCTCCGTCCCG)2 is associated with increased risk of Drug Toxicity when treated with mercaptopurine and methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma.
Evidence: -; PMID 22838948
C18orf56 (PA134956204),"TYMS (PA359)" rs45445694
Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with decreased event free survival when treated with methotrexate in people with Precursor Cell Lymphoblastic Leukemia-Lymphoma.
Evidence: -; PMID 12972956
C18orf56 (PA134956204),"TYMS (PA359)" rs45445694
Allele (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with decreased likelihood of event free survival when treated with methotrexate in people with Precursor Cell Lymphoblastic Leukemia-Lymphoma.
Evidence: -; PMID 14647408
TYMS (PA359) rs45445694
Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with increased risk of Stomatitis when treated with methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.
Evidence: -; PMID 23652803
TYMS (PA359) rs45445694
Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is not associated with increased likelihood of Drug Toxicity when treated with mercaptopurine and methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.
Evidence: -; PMID 17323057
C18orf56 (PA134956204),"TYMS (PA359)" rs45445694
Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with decreased progression free survival when treated with methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.
Evidence: -; PMID 11937185
C18orf56 (PA134956204),"TYMS (PA359)" rs45445694
Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with increased risk of CNS relapse when treated with asparaginase, cytarabine, daunorubicin, dexamethasone, etoposide, mercaptopurine, methotrexate and vincristine in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.
Evidence: -; PMID 15713801
C18orf56 (PA134956204),"TYMS (PA359)" rs45445694
Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with increased risk of hematologic relapse when treated with asparaginase, cytarabine, daunorubicin, etoposide, mercaptopurine, methotrexate, prednisone and vincristine in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.
Evidence: -; PMID 15713801
FASTKD3 (PA145148868),"MTRR (PA31277)" rs1801394
Allele G is not associated with decreased IQ when treated with methotrexate in people with Precursor Cell Lymphoblastic Leukemia-Lymphoma.
Evidence: -; PMID 16013960
TYMS (PA359) rs2853542
Genotype GG is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotypes CC + CG.
Evidence: -; PMID 22763757
SLC19A1 (PA327) rs1051266
Genotype CC is associated with increased risk of Drug Toxicity when treated with methotrexate in people with Arthritis, Rheumatoid as compared to genotypes CT + TT.
Evidence: -; PMID 25074866
MTHFR (PA245) rs1801133
Allele G is not associated with likelihood of Drug Toxicity, Infection and Stomatitis when treated with mercaptopurine and methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to allele A.
Evidence: -; PMID 18987660
C18orf56 (PA134956204),"TYMS (PA359)" rs45445694
Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.
Evidence: -; PMID 15457444
C18orf56 (PA134956204),"TYMS (PA359)" rs45445694
Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with increased response to folic acid, hydroxychloroquine, methotrexate and sulfasalazine in people with Arthritis, Rheumatoid as compared to genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3.
Evidence: -; PMID 18322994
MTHFR (PA245) rs1801133
Allele A is associated with increased likelihood of Drug Toxicity when treated with methotrexate in people with Arthritis, Rheumatoid as compared to allele G.
Evidence: -; PMID 27992285
ABCB1 (PA267) rs1045642
Genotype AA is associated with increased risk of Anemia and Thrombocytopenia when treated with doxorubicin, methotrexate, prednisolone and vincristine in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes AG + GG.
Evidence: -; PMID 25582575
SLC28A3 (PA426) rs10868138
Genotypes CC + CT is associated with increased risk of Leukopenia when treated with mercaptopurine and methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotype TT.
Evidence: -; PMID 26237184
DHFR (PA143) rs408626
Genotype TT is associated with decreased event-free survival when treated with methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes CC + CT.
Evidence: -; PMID 29210328
NALCN (PA162396840) rs7992226
Allele A is associated with increased clearance of methotrexate in people with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to allele G.
Evidence: -; PMID 19176441
- rs4888024
Allele G is associated with end-of-induction minimal risidual disease (MRD) in childhood acute lymphoblastic leukemia (ALL) and is also associated with greater methotrexate clearance when treated with methotrexate as compared to allele A.
Evidence: -; PMID 19176441
FASTKD3 (PA145148868),"MTRR (PA31277)" rs1801394
Genotypes AA + AG is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotype GG.
Evidence: -; PMID 27676277
MTRR (PA31277) rs1801394
Allele A is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to allele G.
Evidence: -; PMID 29743634
TYMS (PA359) rs11280056
Genotype TTA/TTA is associated with increased likelihood of gastrointestinal toxicity when treated with methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes TTA/TTAAAGTTA + TTAAAGTTA/TTAAAGTTA.
Evidence: -; PMID 32344632
SOURCE
NLM RxNorm
7 name rows
Drug Names / RxNorm
Normalized drug-name vocabulary rows, RxCUIs, and source abbreviations.
| Name | RxCUI | Type | Source |
|---|---|---|---|
| METHOTREXATE | 6851 | SU | MTHSPL |
| methotrexate | 6851 | SU | MTHSPL |
| methotrexate sodium | 287734 | SU | MTHSPL |
| METHOTREXATE SODIUM | 287734 | SU | MTHSPL |
| methotrexate | 6851 | IN | RXNORM |
| Trexall | 284900 | BN | RXNORM |
| methotrexate sodium | 287734 | PIN | RXNORM |
SOURCE
SIDER
80 side-effect rows
Side Effects
SIDER side-effect terms mapped to the drug or same-CAS compound identity.
| Side Effect | Drug Name | MedDRA Type | Concept ID |
|---|---|---|---|
| Abdominal discomfort | methotrexate | LLT | C0232487 |
| Abdominal discomfort | methotrexate | PT | C0232487 |
| Abdominal discomfort | methotrexate | PT | C0232487 |
| Abdominal distress | methotrexate | LLT | C0235295 |
| Abdominal pain | methotrexate | LLT | C0000737 |
| Abdominal pain | methotrexate | PT | C0000737 |
| Abscess | methotrexate | LLT | C0000833 |
| Abscess | methotrexate | PT | C0000833 |
| Agranulocytosis | methotrexate | LLT | C0001824 |
| Agranulocytosis | methotrexate | PT | C0001824 |
| Allergic cutaneous angiitis | methotrexate | LLT | C0151436 |
| Alopecia | methotrexate | LLT | C0002170 |
| Alopecia | methotrexate | PT | C0002170 |
| Alveolitis | methotrexate | LLT | C0549493 |
| Alveolitis | methotrexate | PT | C0549493 |
| Alveolitis allergic | methotrexate | LLT | C0002390 |
| Alveolitis allergic | methotrexate | PT | C0002390 |
| Anaemia | methotrexate | LLT | C0002871 |
| Anaemia | methotrexate | PT | C0002871 |
| Anaemia megaloblastic | methotrexate | LLT | C0002888 |
| Anaemia megaloblastic | methotrexate | PT | C0002888 |
| Anaphylactic shock | methotrexate | LLT | C0002792 |
| Anaphylactic shock | methotrexate | PT | C0002792 |
| Anaphylactic shock | methotrexate | PT | C0002792 |
| Anaphylactoid reaction | methotrexate | LLT | C0340865 |
| Anaphylactoid reaction | methotrexate | PT | C0340865 |
| Angiopathy | methotrexate | LLT | C0042373 |
| Angiopathy | methotrexate | PT | C0042373 |
| Anorexia | methotrexate | LLT | C0003123 |
| Anuria | methotrexate | LLT | C0003460 |
| Anuria | methotrexate | PT | C0003460 |
| Aphasia | methotrexate | LLT | C0003537 |
| Aphasia | methotrexate | PT | C0003537 |
| Aplastic anaemia | methotrexate | LLT | C0002874 |
| Aplastic anaemia | methotrexate | PT | C0002874 |
| Apnoea | methotrexate | LLT | C0003578 |
| Apnoea | methotrexate | PT | C0003578 |
| Appetite absent | methotrexate | LLT | C1971624 |
| Arachnoiditis | methotrexate | LLT | C0003708 |
| Arachnoiditis | methotrexate | PT | C0003708 |
| Arterial thrombosis | methotrexate | LLT | C0151942 |
| Arterial thrombosis | methotrexate | PT | C0151942 |
| Arthralgia | methotrexate | LLT | C0003862 |
| Arthralgia | methotrexate | PT | C0003862 |
| Aseptic necrosis | methotrexate | LLT | C0085660 |
| Asthenia | methotrexate | LLT | C0004093 |
| Asthenia | methotrexate | PT | C0004093 |
| Asthenia | methotrexate | PT | C0004093 |
| Asthma | methotrexate | LLT | C0004096 |
| Asthma | methotrexate | PT | C0004096 |
| Ataxia | methotrexate | LLT | C0004134 |
| Ataxia | methotrexate | PT | C0004134 |
| Azoospermia | methotrexate | PT | C0004509 |
| Azotaemia | methotrexate | LLT | C0242528 |
| Azotaemia | methotrexate | PT | C0242528 |
| Back pain | methotrexate | LLT | C0004604 |
| Back pain | methotrexate | PT | C0004604 |
| Bacterial infection | methotrexate | LLT | C0004623 |
| Bacterial infection | methotrexate | PT | C0004623 |
| Bladder pain | methotrexate | PT | C0232849 |
| Blindness transient | methotrexate | LLT | C0155003 |
| Blindness transient | methotrexate | PT | C0155003 |
| Blood albumin decreased | methotrexate | PT | C0853777 |
| Blood and lymphatic system disorders | methotrexate | - | C0851353 |
| Blood uric acid increased | methotrexate | PT | C0235416 |
| Body temperature increased | methotrexate | LLT | C0015967 |
| Body temperature increased | methotrexate | PT | C0015967 |
| Bone disorder | methotrexate | LLT | C0005940 |
| Bone disorder | methotrexate | PT | C0005940 |
| Bone marrow depression | methotrexate | LLT | C0151773 |
| Breast disorder | methotrexate | LLT | C0006145 |
| Breast disorder | methotrexate | PT | C0006145 |
| Bronchial hyperreactivity | methotrexate | PT | C0085129 |
| Burkitt's lymphoma | methotrexate | LLT | C0006413 |
| Burkitt's lymphoma | methotrexate | PT | C0006413 |
| Burning sensation | methotrexate | LLT | C0085624 |
| Burning sensation | methotrexate | PT | C0085624 |
| CNS toxicity | methotrexate | LLT | C3160947 |
| Carcinogenicity | methotrexate | LLT | C0858970 |
| Carcinogenicity | methotrexate | PT | C0858970 |
SOURCE
Rendered pharma page rows
FAQPage JSON-LD
Frequently Asked Questions
Short answers generated only from the same visible source-linked rows on this page.
What is Methotrexate used for in pharmaceutical contexts?
Methotrexate (CAS 59-05-2) is rendered as a pharmaceutical compound from the matched source rows; no DailyMed product-name rows are present in this page query.
What are the known adverse events for Methotrexate?
Methotrexate has 2,431 DrugCentral/FAERS adverse event associations. Rendered reaction terms include Drug ineffective, Drug intolerance, Treatment failure, Joint swelling, Arthralgia. Signal rows are source-linked records and should not be read as incidence rates or causality conclusions.
Is Methotrexate also used in cosmetics?
Yes. The ingredients table has a same-CAS cosmetic profile for Methotrexate with EU status "prohibited".
What clinical phase is Methotrexate in?
Methotrexate is rendered with ChEMBL max phase 4 (approved).
What bioactivity targets are documented for Methotrexate?
Methotrexate has 49 bioactivity rows in this page query. Rendered target entries include Multidrug resistance protein 1, Canalicular multispecific organic anion transporter 1, Multidrug resistance-associated protein 1, ATP-binding cassette sub-family G member 2, Thymidylate synthase.